pll 3 7 Search Results


95
Addgene inc scramble shrna construct
Scramble Shrna Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pm41644943-338-0-11?v=Addgene+inc
Average 95 stars, based on 1 article reviews
scramble shrna construct - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc pll3 7 ef eyfp yap1 s94a polya
Pll3 7 Ef Eyfp Yap1 S94a Polya, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/bio_rxiv__2025__10__28__685193-61-6-7?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pll3 7 ef eyfp yap1 s94a polya - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc shrna control
Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pm40514677-113-13-21?v=Addgene+inc
Average 93 stars, based on 1 article reviews
shrna control - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

88
Addgene inc judy lieberman
Judy Lieberman, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pm33596979-145-99-101?v=Addgene+inc
Average 88 stars, based on 1 article reviews
judy lieberman - by Bioz Stars, 2026-07
88/100 stars
  Buy from Supplier

93
Addgene inc 156 pll3 7 flag yap1 tead p h2b mcherry
156 Pll3 7 Flag Yap1 Tead P H2b Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pmc11849000__nl4c04290_si_002-81-22-25?v=Addgene+inc
Average 93 stars, based on 1 article reviews
156 pll3 7 flag yap1 tead p h2b mcherry - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc plasmids pll3 7 ef eyfp yap1 wt polya
Plasmids Pll3 7 Ef Eyfp Yap1 Wt Polya, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/bio_rxiv__2025__10__28__685193-61-0-2?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plasmids pll3 7 ef eyfp yap1 wt polya - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc vector pll3 7 hsa mir 150
Vector Pll3 7 Hsa Mir 150, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pmc08865640-188-3-19?v=Addgene+inc
Average 93 stars, based on 1 article reviews
vector pll3 7 hsa mir 150 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

91
Addgene inc pegfp taz
Pegfp Taz, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/bio_rxiv__2023__07__24__550444-151-2-19?v=Addgene+inc
Average 91 stars, based on 1 article reviews
pegfp taz - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

91
Addgene inc yap tead reporter
Yap Tead Reporter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pm30904599-81-29-31?v=Addgene+inc
Average 91 stars, based on 1 article reviews
yap tead reporter - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

86
Addgene inc pll3 7 k122 23 fh yap1 ires gfp tead
Pll3 7 K122 23 Fh Yap1 Ires Gfp Tead, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/10__1158_slash_1541___7786__mcr___17___0382-78-33-14?v=Addgene+inc
Average 86 stars, based on 1 article reviews
pll3 7 k122 23 fh yap1 ires gfp tead - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

93
Addgene inc sherk2
High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), <t>shERK2</t> ( blue ), or shControl Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.
Sherk2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/pmc08892083-141-5-11?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sherk2 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc s5a yap1 yfp vectors
A. Heatmap showing the z-score protein expression in CAFs and TGFβ1-stimulated NF1 (T-NF) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools), on triplicates. Data from MS analysis. Top up- and downregulated proteins after Hsp90aa1 silencing in both systems are shown. YAP targets are indicated. B. Graphs show z-score protein expression of YAP targets Diaph3, Anln and Birc5 in CAFs and TGFβ1-stimulated NF1 (T-NF) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools)(n=3). C. GSEA plots showing the enrichment of the indicated signatures (based on MS-proteomics data) in Hsp90aa1 -depleted CAF1 compared with CAF1 control (red line), Hsp90ab1 -depleted CAF1 compared with the CAF1 control (green line), Hsp90aa1 -depleted TGFβ1-stimulated NF1 compared with the TGFβ1-stimulated control (blue line) and Hsp90ab1 -depleted TGFβ1-stimulated NF1 compared with the TGFβ1-stimulated control (purple line). NES and FDR coefficients are indicated. D. Diagram illustrating the key components of the Hippo pathway. The core components are the kinases MST1/2 (STK3/4) and LATS1/2 that promote serine phosphorylation of key residues in YAP/TAZ and in its inactivation. Phosphatases PP2/PP5 inhibit LATS1/2 phosphorylation/activation and also dephosphorylate YAP/TAZ, promoting its transcriptional activity. E. Heatmap showing the mean z-score protein expression value of Hippo pathway components in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (mean on n=3). Heatmap on the right shows the log2(FC) value of T-NF-siC vs T-NF-siAA and CAF-siC vs CAF-siAA. F. Graphs show z-score protein expression of selected Hippo pathway components Lats1, Ppp2ca, Ppd2cb and Ppp5c in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (n=3). G. Images and graph show gel contraction assays of NF1 cells constitutively expressing a Hippo insensitive YAP mutant <t>(YAP-S5A)</t> after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools)(n=12). H. Graph show z-score protein expression of selected Taz/Wwtr1 in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (n=3). I. Graphs show correlation between Taz expression (represented as z-score of MS-proteomics data) and the level of YAP/TAZ activity (represented as z-score of ssGSEA value of “Non_Prolif_YAPTAZ” signature from RNAseq data, left) and the level of activity of a TAZ-specific signature (represented as z-score of ssGSEA value of “Zhang_TAZ_Genes_not_YAP” from RNAseq data, right). Each dot represents the mean of 3 replicates from proteomics and RNAseq data for murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, individual p values are shown; alternatively, the following symbols were used to describe statistical significance: *, P < 0.05; ***, P < 0.001.
S5a Yap1 Yfp Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pll+3+7/bio_rxiv__2025__04__04__647210-259-14-17?v=Addgene+inc
Average 93 stars, based on 1 article reviews
s5a yap1 yfp vectors - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results


High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or shControl Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.

Journal: The Journal of Biological Chemistry

Article Title: Subcellular regulation of glucose metabolism through multienzyme glucosome assemblies by EGF–ERK1/2 signaling pathways

doi: 10.1016/j.jbc.2022.101675

Figure Lengend Snippet: High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or shControl Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.

Article Snippet: The plasmids expressing shERK1 and shERK2 contains the sequence of CATGAAGGCCCGAAACTAC (Addgene, Cat# 65228) and CCAGATCCTCAGAGGGTTAAA (Addgene, Cat#65229), respectively ( ).

Techniques: Imaging, Comparison

Western blot analysis of ERK1/2 knockdown. Epidermal growth factor-treated Hs578T cells were transfected with shERK1, shERK2, or shControl Scrambled and subsequently selected in the presence of puromycin (1 μg/ml). A , Western blot analysis showed the knockdown of total ERK1/2, but no change was detected for pERK1/2 in the presence of shERK1/2. B and C , expression levels of total ERK1/2 and phosphorylated ERK1/2 (pERK1/2) were normalized based on load controls (β-actin), respectively. The error bars represent the SDs of at least three independent experiments. Statistical analyses were performed using two-sample two-tailed t test. ∗ p < 0.05, ∗∗ p < 0.01. N.S.; not significant. ERK, extracellular signal-regulated kinase.

Journal: The Journal of Biological Chemistry

Article Title: Subcellular regulation of glucose metabolism through multienzyme glucosome assemblies by EGF–ERK1/2 signaling pathways

doi: 10.1016/j.jbc.2022.101675

Figure Lengend Snippet: Western blot analysis of ERK1/2 knockdown. Epidermal growth factor-treated Hs578T cells were transfected with shERK1, shERK2, or shControl Scrambled and subsequently selected in the presence of puromycin (1 μg/ml). A , Western blot analysis showed the knockdown of total ERK1/2, but no change was detected for pERK1/2 in the presence of shERK1/2. B and C , expression levels of total ERK1/2 and phosphorylated ERK1/2 (pERK1/2) were normalized based on load controls (β-actin), respectively. The error bars represent the SDs of at least three independent experiments. Statistical analyses were performed using two-sample two-tailed t test. ∗ p < 0.05, ∗∗ p < 0.01. N.S.; not significant. ERK, extracellular signal-regulated kinase.

Article Snippet: The plasmids expressing shERK1 and shERK2 contains the sequence of CATGAAGGCCCGAAACTAC (Addgene, Cat# 65228) and CCAGATCCTCAGAGGGTTAAA (Addgene, Cat#65229), respectively ( ).

Techniques: Western Blot, Knockdown, Transfection, Expressing, Two Tailed Test

A. Heatmap showing the z-score protein expression in CAFs and TGFβ1-stimulated NF1 (T-NF) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools), on triplicates. Data from MS analysis. Top up- and downregulated proteins after Hsp90aa1 silencing in both systems are shown. YAP targets are indicated. B. Graphs show z-score protein expression of YAP targets Diaph3, Anln and Birc5 in CAFs and TGFβ1-stimulated NF1 (T-NF) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools)(n=3). C. GSEA plots showing the enrichment of the indicated signatures (based on MS-proteomics data) in Hsp90aa1 -depleted CAF1 compared with CAF1 control (red line), Hsp90ab1 -depleted CAF1 compared with the CAF1 control (green line), Hsp90aa1 -depleted TGFβ1-stimulated NF1 compared with the TGFβ1-stimulated control (blue line) and Hsp90ab1 -depleted TGFβ1-stimulated NF1 compared with the TGFβ1-stimulated control (purple line). NES and FDR coefficients are indicated. D. Diagram illustrating the key components of the Hippo pathway. The core components are the kinases MST1/2 (STK3/4) and LATS1/2 that promote serine phosphorylation of key residues in YAP/TAZ and in its inactivation. Phosphatases PP2/PP5 inhibit LATS1/2 phosphorylation/activation and also dephosphorylate YAP/TAZ, promoting its transcriptional activity. E. Heatmap showing the mean z-score protein expression value of Hippo pathway components in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (mean on n=3). Heatmap on the right shows the log2(FC) value of T-NF-siC vs T-NF-siAA and CAF-siC vs CAF-siAA. F. Graphs show z-score protein expression of selected Hippo pathway components Lats1, Ppp2ca, Ppd2cb and Ppp5c in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (n=3). G. Images and graph show gel contraction assays of NF1 cells constitutively expressing a Hippo insensitive YAP mutant (YAP-S5A) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools)(n=12). H. Graph show z-score protein expression of selected Taz/Wwtr1 in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (n=3). I. Graphs show correlation between Taz expression (represented as z-score of MS-proteomics data) and the level of YAP/TAZ activity (represented as z-score of ssGSEA value of “Non_Prolif_YAPTAZ” signature from RNAseq data, left) and the level of activity of a TAZ-specific signature (represented as z-score of ssGSEA value of “Zhang_TAZ_Genes_not_YAP” from RNAseq data, right). Each dot represents the mean of 3 replicates from proteomics and RNAseq data for murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, individual p values are shown; alternatively, the following symbols were used to describe statistical significance: *, P < 0.05; ***, P < 0.001.

Journal: bioRxiv

Article Title: Proteostasis control via HSP90α sustains YAP activity to drive aggressive behaviours in cancer-associated fibroblasts

doi: 10.1101/2025.04.04.647210

Figure Lengend Snippet: A. Heatmap showing the z-score protein expression in CAFs and TGFβ1-stimulated NF1 (T-NF) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools), on triplicates. Data from MS analysis. Top up- and downregulated proteins after Hsp90aa1 silencing in both systems are shown. YAP targets are indicated. B. Graphs show z-score protein expression of YAP targets Diaph3, Anln and Birc5 in CAFs and TGFβ1-stimulated NF1 (T-NF) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools)(n=3). C. GSEA plots showing the enrichment of the indicated signatures (based on MS-proteomics data) in Hsp90aa1 -depleted CAF1 compared with CAF1 control (red line), Hsp90ab1 -depleted CAF1 compared with the CAF1 control (green line), Hsp90aa1 -depleted TGFβ1-stimulated NF1 compared with the TGFβ1-stimulated control (blue line) and Hsp90ab1 -depleted TGFβ1-stimulated NF1 compared with the TGFβ1-stimulated control (purple line). NES and FDR coefficients are indicated. D. Diagram illustrating the key components of the Hippo pathway. The core components are the kinases MST1/2 (STK3/4) and LATS1/2 that promote serine phosphorylation of key residues in YAP/TAZ and in its inactivation. Phosphatases PP2/PP5 inhibit LATS1/2 phosphorylation/activation and also dephosphorylate YAP/TAZ, promoting its transcriptional activity. E. Heatmap showing the mean z-score protein expression value of Hippo pathway components in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (mean on n=3). Heatmap on the right shows the log2(FC) value of T-NF-siC vs T-NF-siAA and CAF-siC vs CAF-siAA. F. Graphs show z-score protein expression of selected Hippo pathway components Lats1, Ppp2ca, Ppd2cb and Ppp5c in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (n=3). G. Images and graph show gel contraction assays of NF1 cells constitutively expressing a Hippo insensitive YAP mutant (YAP-S5A) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools)(n=12). H. Graph show z-score protein expression of selected Taz/Wwtr1 in murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools) (n=3). I. Graphs show correlation between Taz expression (represented as z-score of MS-proteomics data) and the level of YAP/TAZ activity (represented as z-score of ssGSEA value of “Non_Prolif_YAPTAZ” signature from RNAseq data, left) and the level of activity of a TAZ-specific signature (represented as z-score of ssGSEA value of “Zhang_TAZ_Genes_not_YAP” from RNAseq data, right). Each dot represents the mean of 3 replicates from proteomics and RNAseq data for murine NF1 after transfection with control (NF-siC), and TGFβ1-stimulated NF1 (T-NF) or CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, individual p values are shown; alternatively, the following symbols were used to describe statistical significance: *, P < 0.05; ***, P < 0.001.

Article Snippet: Lentiviral plasmids for expression of wild-type and mutant YAP were YAP1-YFP (#112284, Addgene) and S5A-YAP1-YFP vectors (#112285, Addgene), respectively.

Techniques: Expressing, Transfection, Control, Activation Assay, Activity Assay, Mutagenesis

A-B. Western blots show expression levels of Yap, Taz and Gapdh in murine NF1 (A) and NF4 (B) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, cells were stimulated TGFβ1. Fold expression levels (relative to Gapdh) are indicated. C. Western blots of Yap, Taz and Gapdh in unstimulated NF WT and NF KO . Fold expression levels (relative to Gapdh) are indicated. D-E. Western blots show phospho-S127-Yap, Yap and Tubulin expression (D), or β-catenin (βcat) and Gapdh expression (E) in murine CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Fold expression levels (relative to Tubulin or Gapdh) are indicated. F-G. Western blots show Yap, Taz and Gapdh expression in TGFβ1-stimulated NF1 after transfection with control (siC) or Hsp90aa1 (siAA) RNAi (smart-pools) (F) and in the NF WT /NF KO system (G) during pulse-chase with CHX at 0 h and 3 h. Graphs show quantification of Yap and Taz expression (relative to Gapdh) at 3 h of CHX treatment relative to the expression at 0 h for each condition. H. Western blot shows expression of hippo-insensitive YAP mutant (YAP MUT ) stably expressed in murine NF1, and Gapdh after transfection with control (siC) or Hsp90aa1 (siAA) RNAi (smart-pools) during pulse-chase with CHX at 0 h and 3 h. Graph shows quantification of YAP MUT expression (relative to Gapdh) at 3 h of CHX treatment relative to the expression at 0 h for each condition (n=3). I. Diagram illustrating the genome editing strategy to introduce a V5-dTAG tandem in frame with the Yap1 locus in murine NF1 and CAF1. This strategy enabled the specific immunoprecipitation of endogenous Yap with its own internal control after dTAG-induced targeted degradation. Ub: ubiquitin. J. Western blots show co-immunoprecipitation of Hsp90, Lats1 and 14-3-3 with V5-YAP (anti-V5) in NF1-V5-Yap-dTAG cells treated with vehicle (Vh), TGFβ1 or dTAG. Corresponding total lysates for all antibodies are also shown. K. Graph shows fold levels of interaction between Hsp90 and YAP-V5-dTAG in NF1 and CAF1 after treatment with vehicle (Vh) or TGFβ1, as inferred from co-immunoprecipitation assays in (J) and in . L. Graphs show Src and Yes1 fold mRNA expression in TGFβ1-stimulated NF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Data from RNAseq (n=3). M. Western blots show the expression levels of Src, Yes1 and Gapdh in murine NF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, cells were stimulated with TGFβ1. Fold expression levels (relative to Gapdh) are indicated. N. Western blot shows expression levels of Yes1, Hsp90 and Tubulin in murine CAF1 after transfection with control (siC) or Hsp90aa1 (siAA) RNAi (smart-pools) during pulse-chase with CHX at 0 h and 3 h. Graph represents quantification of Yes1 (relative to Actin) at 3 h of CHX treatment relative to the expression at 0 h for both conditions (n=4). Where indicated, individual p values are shown; alternatively, the following symbols were used to describe statistical significance: **, P < 0.01.

Journal: bioRxiv

Article Title: Proteostasis control via HSP90α sustains YAP activity to drive aggressive behaviours in cancer-associated fibroblasts

doi: 10.1101/2025.04.04.647210

Figure Lengend Snippet: A-B. Western blots show expression levels of Yap, Taz and Gapdh in murine NF1 (A) and NF4 (B) after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, cells were stimulated TGFβ1. Fold expression levels (relative to Gapdh) are indicated. C. Western blots of Yap, Taz and Gapdh in unstimulated NF WT and NF KO . Fold expression levels (relative to Gapdh) are indicated. D-E. Western blots show phospho-S127-Yap, Yap and Tubulin expression (D), or β-catenin (βcat) and Gapdh expression (E) in murine CAF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Fold expression levels (relative to Tubulin or Gapdh) are indicated. F-G. Western blots show Yap, Taz and Gapdh expression in TGFβ1-stimulated NF1 after transfection with control (siC) or Hsp90aa1 (siAA) RNAi (smart-pools) (F) and in the NF WT /NF KO system (G) during pulse-chase with CHX at 0 h and 3 h. Graphs show quantification of Yap and Taz expression (relative to Gapdh) at 3 h of CHX treatment relative to the expression at 0 h for each condition. H. Western blot shows expression of hippo-insensitive YAP mutant (YAP MUT ) stably expressed in murine NF1, and Gapdh after transfection with control (siC) or Hsp90aa1 (siAA) RNAi (smart-pools) during pulse-chase with CHX at 0 h and 3 h. Graph shows quantification of YAP MUT expression (relative to Gapdh) at 3 h of CHX treatment relative to the expression at 0 h for each condition (n=3). I. Diagram illustrating the genome editing strategy to introduce a V5-dTAG tandem in frame with the Yap1 locus in murine NF1 and CAF1. This strategy enabled the specific immunoprecipitation of endogenous Yap with its own internal control after dTAG-induced targeted degradation. Ub: ubiquitin. J. Western blots show co-immunoprecipitation of Hsp90, Lats1 and 14-3-3 with V5-YAP (anti-V5) in NF1-V5-Yap-dTAG cells treated with vehicle (Vh), TGFβ1 or dTAG. Corresponding total lysates for all antibodies are also shown. K. Graph shows fold levels of interaction between Hsp90 and YAP-V5-dTAG in NF1 and CAF1 after treatment with vehicle (Vh) or TGFβ1, as inferred from co-immunoprecipitation assays in (J) and in . L. Graphs show Src and Yes1 fold mRNA expression in TGFβ1-stimulated NF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Data from RNAseq (n=3). M. Western blots show the expression levels of Src, Yes1 and Gapdh in murine NF1 after transfection with control (siC), Hsp90aa1 (siAA) or Hsp90ab1 (siAB) RNAi (smart-pools). Where indicated, cells were stimulated with TGFβ1. Fold expression levels (relative to Gapdh) are indicated. N. Western blot shows expression levels of Yes1, Hsp90 and Tubulin in murine CAF1 after transfection with control (siC) or Hsp90aa1 (siAA) RNAi (smart-pools) during pulse-chase with CHX at 0 h and 3 h. Graph represents quantification of Yes1 (relative to Actin) at 3 h of CHX treatment relative to the expression at 0 h for both conditions (n=4). Where indicated, individual p values are shown; alternatively, the following symbols were used to describe statistical significance: **, P < 0.01.

Article Snippet: Lentiviral plasmids for expression of wild-type and mutant YAP were YAP1-YFP (#112284, Addgene) and S5A-YAP1-YFP vectors (#112285, Addgene), respectively.

Techniques: Western Blot, Expressing, Transfection, Control, Pulse Chase, Mutagenesis, Stable Transfection, Introduce, Immunoprecipitation